Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0091017 | |||
Gene | TAF1 | Organism | Human |
Genome Locus | chrX:70601592-70607311:+ | Build | hg19 |
Disease | Bladder Cancer | ICD-10 | Malignant neoplasm of Bladder, unspecified (C67.9) |
DBLink | Link to database | PMID | 29151929 |
Experimental Method | |||
Sample Type | Tissues | Comparison | five matched samples of bladder cancer and adjacent non-tumour tissue |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward ATCATTCGGACAAGACAGG ReverseTCCATATACCAGATCCTCATTG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Yang, X, Yuan, W, Tao, J, Li, P, Yang, C, Deng, X, Zhang, X, Tang, J, Han, J, Wang, J, Li, P, Lu, Q, Gu, M (2017). Identification of circular RNA signature in bladder cancer. J Cancer, 8, 17:3456-3463. |